Spike Protein Sars2

Lab Reagents

Human IgG antibody Laboratories manufactures the spike protein sars2 reagents distributed by Genprice. The Spike Protein Sars2 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Spike Protein. Other Spike products are available in stock. Specificity: Spike Category: Protein Group: Sars2

Sars2 information

anti-SARS2

YF-PA19458 50 ug
EUR 363
Description: Mouse polyclonal to SARS2

anti-SARS2

YF-PA19459 100 ul
EUR 403
Description: Rabbit polyclonal to SARS2

anti-SARS2

YF-PA19460 100 ug
EUR 403
Description: Rabbit polyclonal to SARS2

SARS2 Recombinant Protein (Human)

RP027610 100 ug Ask for price

SARS2 Recombinant Protein (Rat)

RP227483 100 ug Ask for price

SARS2 Recombinant Protein (Mouse)

RP170015 100 ug Ask for price

anti- SARS2 antibody

FNab07610 100µg
EUR 548.75
  • Immunogen: seryl-tRNA synthetase 2, mitochondrial
  • Uniprot ID: Q9NP81
  • Gene ID: 54938
  • Research Area: Metabolism
Description: Antibody raised against SARS2

SARS2 Rabbit pAb

A12297-100ul 100 ul
EUR 308

SARS2 Rabbit pAb

A12297-200ul 200 ul
EUR 459

SARS2 Rabbit pAb

A12297-20ul 20 ul
EUR 183

SARS2 Rabbit pAb

A12297-50ul 50 ul
EUR 223

SARS2 Polyclonal Antibody

27672-100ul 100ul
EUR 252

SARS2 Polyclonal Antibody

27672-50ul 50ul
EUR 187

SARS2 cloning plasmid

CSB-CL878836HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1557
  • Sequence: atggctgcgtccatggcgcggcgcttgtggcctttgctgactcgtcgggggttccggccccggggaggctgcatctccaacgatagtccaaggagaagtttcactacagagaaacgaaaccggaacctcctgtacgagtatgcgcgcgagggctacagcgcactccctcagctgg
  • Show more
Description: A cloning plasmid for the SARS2 gene.

Anti-SARS2 antibody

PAab07610 100 ug
EUR 386

Anti-SARS2 antibody

STJ114185 100 µl
EUR 277
Description: This gene encodes the mitochondrial seryl-tRNA synthethase precursor, a member of the class II tRNA synthetase family. The mature enzyme catalyzes the ligation of Serine to tRNA(Ser) and participates in the biosynthesis of selenocysteinyl-tRNA(sec) in mitochondria. The enzyme contains an N-terminal tRNA binding domain and a core catalytic domain. It functions in a homodimeric form, which is stabilized by tRNA binding. This gene is regulated by a bidirectional promoter that also controls the expression of mitochondrial ribosomal protein S12. Both genes are within the critical interval for the autosomal dominant deafness locus DFNA4 and might be linked to this disease. Multiple transcript variants encoding different isoforms have been identified for this gene.

SARS-CoV Spike Protein

abx060655-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.