Fda Approved Sars2 Rapid Testing

Lab Reagents

Human IgG antibody Laboratories manufactures the fda approved sars2 rapid testing reagents distributed by Genprice. The Fda Approved Sars2 Rapid Testing reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SARS Rapid. Other Fda products are available in stock. Specificity: Fda Category: Approved Group: Sars2 Rapid

Sars2 Rapid information

anti- SARS2 antibody

FNab07610 100µg
EUR 548.75
  • Immunogen: seryl-tRNA synthetase 2, mitochondrial
  • Uniprot ID: Q9NP81
  • Gene ID: 54938
  • Research Area: Metabolism
Description: Antibody raised against SARS2

SARS2 Rabbit pAb

A12297-100ul 100 ul
EUR 308

SARS2 Rabbit pAb

A12297-200ul 200 ul
EUR 459

SARS2 Rabbit pAb

A12297-20ul 20 ul
EUR 183

SARS2 Rabbit pAb

A12297-50ul 50 ul
EUR 223

SARS2 Polyclonal Antibody

27672-100ul 100ul
EUR 252

SARS2 Polyclonal Antibody

27672-50ul 50ul
EUR 187

SARS2 cloning plasmid

CSB-CL878836HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1557
  • Sequence: atggctgcgtccatggcgcggcgcttgtggcctttgctgactcgtcgggggttccggccccggggaggctgcatctccaacgatagtccaaggagaagtttcactacagagaaacgaaaccggaacctcctgtacgagtatgcgcgcgagggctacagcgcactccctcagctgg
  • Show more
Description: A cloning plasmid for the SARS2 gene.

Anti-SARS2 antibody

PAab07610 100 ug
EUR 386

Anti-SARS2 antibody

STJ114185 100 µl
EUR 277
Description: This gene encodes the mitochondrial seryl-tRNA synthethase precursor, a member of the class II tRNA synthetase family. The mature enzyme catalyzes the ligation of Serine to tRNA(Ser) and participates in the biosynthesis of selenocysteinyl-tRNA(sec) in mitochondria. The enzyme contains an N-terminal tRNA binding domain and a core catalytic domain. It functions in a homodimeric form, which is stabilized by tRNA binding. This gene is regulated by a bidirectional promoter that also controls the expression of mitochondrial ribosomal protein S12. Both genes are within the critical interval for the autosomal dominant deafness locus DFNA4 and might be linked to this disease. Multiple transcript variants encoding different isoforms have been identified for this gene.

Human FDA ELISA Kit

EHF0220 96Tests
EUR 521

Goat FDA ELISA Kit

EGTF0220 96Tests
EUR 521

Canine FDA ELISA Kit

ECF0220 96Tests
EUR 521

Bovine FDA ELISA Kit

EBF0220 96Tests
EUR 521

Anserini FDA ELISA Kit

EAF0220 96Tests
EUR 521

Porcine FDA ELISA Kit

EPF0220 96Tests
EUR 521

Rat FDA ELISA Kit

ERF0220 96Tests
EUR 521